sppA [2020-10-09 15:12:46]

protease, promotes resistance to antimicrobial peptides

Locus: BSU_29530

Isoelectric point: 7.31

Molecular weight: 36.52 kDa

Protein length: 335 aa

Gene length: 1008 bp

Function: protein secretion

Product: signal peptide peptidase

Essential: no

Synonyms: yteI

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Coping with stress → Resistance against toxins/ antibiotics
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,020,040 3,021,047

Phenotypes of a mutant

• more sensitive to nisin PubMed

The protein

Catalyzed reaction/ biological activity

• serine protease that functions to cleave the remnant signal peptides left behind after protein secretion and cleavage by signal peptidases

Protein family

• peptidase S49 family (single member, according to UniProt)

Structure

• 3RST PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: sppA-sppI
  Description: PubMed

  Sigma factors

  • SigW: sigma factor, PubMed, in SigW regulon

  Regulation

  • induced in response to cell wall stress (SigW) PubMed

  Additional information

  • self-processes its own C-termini PubMed

Biological materials

Mutant

• MGNA-A005 (yteI::erm), available at the NBRP B. subtilis, Japan
• BKE29530 (sppA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
• BKK29530 (sppA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC

References

Loading